Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P120B10
Clone ID P120B10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P120B10
Sequence
CGGGACAAGATGGCGCCGTCCACACCGCTGTTGACAG
Sequence Type mRNA
Unitrap ID UNI10888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58329972..58330008 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]


SPLK-Sequence tag 5SP120B10
Sequence
GATCTTAAATACAAATTGTGAGAAACCCCTTTTGGTGTCTAGAACATTCTGAGTTCCCATAATGTTGGCAGAAATGAACA
AGACAGAGAATCTGTGCTGCCAATTAAAAGTGTCTCTAGAGCTGGGGGAGGCTGCTAAAATACCGGTGGTTGAAGTGAGG
TAAGAACAAGCTCCCCTCTTCTTTGTCCATCAGTGGAAGACCATGGACTTGGGTTAGCAGTGACAGCTTGATCACATTCA
CGTTTTATAGTTACGTAGCGGCGGCCTTATTAGGACTGTACTGACAGTTTGCCATTCTATTCTAGATTGGTATATAAATT
CTAAGAAAGGTCGTAGTGTGTTAGATTCTGCTATACCTTTGTNNCCATGGCCTTAACACTGGCTAAATTTCTACATAATG
TATAACTAAGGTATGATCTCAATAAACTCCCTCATTTGAAAATTTTATTTGTGGCTTATCCTTCTAGTGTTTGTTAAACA
TGTAACATGTATGATAGCCTTTAATGCCAG
Sequence Type genomic DNA
Unitrap ID UNI10888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58332408..58332917 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es