Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB882
Clone ID XB882
Vector pGT0pfs
Project baygenomics

Sequence tag XB882
Sequence
ATATAAATGGGAGCATTTATGATGAGGGTGTGGATGAATGGAATATAGCTCGCCTAAATACAGTCTTGGATGTGGTTGAA
GAAGAGTGTGGTATTTCTATTGAGGGGGTAAATACCCCTTATCTCTATTTTGGAATGTGGAAAACAACATTTGCGTGGCA
CACGGAGGACATGGATCTCTACAGTATTAATTATCTCCACTTTGGGGAGCCCAAGTCTTGGTATGCTATACCTCCGGAGC
ATGGAAAGCGACTTGAAAGACTAGCCCAAGGCTTCTTCCCCAGTAGCTCCCAAGGCTGTGATGCATTTCTCCGGCACAAG
ATGACCCTCATTTCCCCCTCAGTGCTGAAGAAGTATGGCATTCCCTTCGACAAGATCACCCAGGAGGCTGGAGAGTTTAT
GATCACTTTTCCTTATGGATATCATGCTGGTTTTAATCATGGTTTCAATTGTGCTGAGTCTACAAATTTTGCTACAGTCA
GATGGATTGACTACGGCAAGGTTGCTAAGTT
Sequence Type mRNA
Unitrap ID UNI1074

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73926890..73961552 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028397 (Jmjd2c) NM_144787 jumonji domain containing 2C Gene [Source:MGI (curated);Acc:Jmjd2c-006]

 
Come back to gene ENSMUSG00000028397


For any suggestions or comments, please send an email to unitrap@crg.es