Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P119B09
Clone ID P119B09
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP119B09
Sequence
AGGTCTCAGTCTTGAAAGAGTTATTTTGGAGTGGGCTATAAATATTTTGTCCTGTGGAGTAGCATACAAAATCAAGGAAA
CCTGCTCAAAAGTACAACAAACTGAAGTGCCTTTAGTCATGGTAATCCTTGTTTCTTTCTCCATTCCTCATAAGCTCATG
GCTGTGCGTTTCTTGTTATGGTCACTGCTTGTCCAGGAGTGTGCCCTACAACAGCCTGCCCCTATGCGTTGGGTAACTTA
CA
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91574788..91575029 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]


SPLK-Sequence tag 3SP119B09
Sequence
TGCCTTCGTCCTTGGTTTAGGCATTACTCCTTTATGGAGTCCCTGTCTCAATCTGTACCAGTGAACAAATGTAAACCATG
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91575296..91575375 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es