Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P119B05
Clone ID P119B05
Vector ROSAbetageo0
Project ggtc

Sequence tag P119B05
Sequence
GTGCAAGNNGTTGNNGCGGAACTAGACGGCCTCNNCCACAGAACCACACACGGNANTTGCCCACNNTAACACCCCCCNNT
TTTTTNNGGGGGNNNGNNNNCCTGTTCTCNAATGGNNNGGGNNNNCTACNNNCCCCTCGAAAATTTAAGAAGGAGGCGCT
GAAATGGGAAAGGGCTCCTCCAAGTACGCCTGNNNCNCAGGCANNNNGAAAGCTGAGCGTGAGCGTGTAATCCTATTGGC
ATTCTCCTGTGGAAATTCGAGGNNNGCAAATCCTATGTGCCCATCATTGATGGCCCAGGACACAGAGACTTCATCAAAAA
CATGATTACAGGCACATCCCAGGCTGACTGTGCTGTCCCTGATTGTTGCCGCTGGTGTTGGTGAATTTGAAGCTGGTATC
TCCAAGAACGGGCAGACCCGCGAGCATGCTCTTCTGGCTTACCCCTGGGTGTGAAACAGCTGATTGTTGGTGTCAACAAA
ATGGATTCCACCGAGCCTCCATACAGTCAGAAGAGATGCGAGTATATGGGCGAGCTAGTCAGCACCTACATTAAGAAAAT
TGGCTACAACCCTGACACAGTAGCATTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAAT
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP119B05
Sequence
AATTTGAAGCTGGTATCTCCAAGAACGGGCAGACCCGCGAGCATGCTCTTCTGGCTTACACCCTGGGTGTGAAACAGCTG
ATTGTTGGTGTCAACAAAATGGATTCCACCGAGCCACCATACAGTCAGAAGAGATACGAGGAAATCGTTAAGGAAGTCAG
CACCTACATTAAGAAAATTGGCTACAACCCTGACACAGTAGCATTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGC
TGGAGCCAAGTGCTAATGTAAGTGACTT
Sequence Type genomic DNA
Unitrap ID UNI19318

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78327648..78327915 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037742 (Eef1a1) NM_010106 eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI (curated);Acc:Eef1a1-001]


SPLK-Sequence tag 3SP119B05
Sequence
TGGCTCAAGAGATGGAGAGCCGCCCGCAAAGANNAGAGTGCCAGTGGCACCACGCTGCTGGAAGCTTTGGATTGTATCCT
ACCACCAACTCGTCCAACTGACAAGCCTCTGCGACTGCCCCTCCAGGATGTCTATAAAATTGGAGGTAAGTAGAATATTA
AGTAGAATGTTGACGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037742


For any suggestions or comments, please send an email to unitrap@crg.es