Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P119A09
Clone ID P119A09
Vector ROSAbetageo0
Project ggtc

Sequence tag P119A09
Sequence
GGGGGGGCCCCGTCCCTGGNNNAAATGNNNGAGGACCCCAGCGGATGTGCCCCCATGGACATANNCCCTCCACCGGCTGT
GAAGGGTTCCCCACGGCNNCTTCGGCCTGGCTCAGAAGCTGATGGACCAGGCCTCCCGAGCCATGATAGGGAGCTCCAAT
GCCAAATACGTCTCCCTGCCATGTCAGGAAGAGTAACAGGGCCGCCCTGCTACTCTATTCCAACACCCTCCACCTTCAGA
TCAGCGAAGTGGAGCCCAAAATCCTATGCAGATGGGGAAGATGCGTATGCAATGAAGCGGGACCTCACACATANNNCTGA
TGAGCTGTCGGGA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP119A09
Sequence
GAATTTGCCCCTAGGCATGTGTCTTGATCCTACCCCCAGGATCAGCGAAGTGGAGCCCAAATACTATGCAGATGGGGAAG
ATGCGTATGCAATGAAGCGGGACCTCACGCAGATGGCTGATGAGGTAAGAGTTCAGCCAGTCCAGGGCAGCAATTCCAGC
AGCAGGGGAGATTCTGTACTTGGGAAAGGTGGCTACTTTAGAGCTGTGAGACTGAGTGAGGCAGTGGTGGCTAGAGGCAA
GACCAAGATTGAGTGTCAGCCCTTGTCGTTGTAGAGCCCCTCTTTCCCTCACTTCCTAAGCTGTCAAGTTGTGACATGGC
CTCTGTTGACTCTAGAGGGGGCTATGGGATGCTTTCTAGGGAAGAAGCCTGGAGGTGGGTGGAACAGGAGAGAGAGTAGG
AAGATATTTTTCTAGGGAGAGGGACTACTAGGGTCAGGGGCAGCCTGCTCAGATTTAGGACTAAACTGGGCTAGGGGGAA
AGGGTCTCTGACCAAGCCTCCTGGGGAGGTACTGCTCTGTCTTGGAGGCTCCCCAACAGCACATTTGAGGGCAATAGGAC
CTTTGTCATTTTACAGATGAGGAAAGCAGGCTTAGGGCAGAGCTAGGATTGAACTACATTTCTACCCAGTCCTATTTCTT
GCCTTGGCCCTACCACTTCTCACTGTGTCCCTTCCCCCAGCCAGCCTCAGGGCCTGGCTCCTCTTGTCTCCTGT
Sequence Type genomic DNA
Unitrap ID UNI29517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71162592..71163305 714
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031388 (Ard1) NM_019870 ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ard1-004]

 
Come back to gene ENSMUSG00000031388


For any suggestions or comments, please send an email to unitrap@crg.es