Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P118H10
Clone ID P118H10
Vector ROSAbetageo0
Project ggtc

Sequence tag P118H10
Sequence
TAATCTTGTCTTCTTCGTGCGAGAAACANNNTGAGGTGAGGTGTGGTCCGGCGGGCTCGNNNNGGAGCNNNCCGCGGCCA
G
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP118H10
Sequence
GGACGAGACGGCGGGGAGGATCATCCCCCTCACCTCCCTGTGCTGCGCCATCCTTAGAGGGGAGGGAGAGGAAAGGGAGA
GCAAGTAAACACTGAGAAACAGGCGCTGGCCCTGCGCAGNNCTTGCCAACATCCGGGAGTTGGCGCCTTTCTTTCCCCTC
ATAGATGTCAGCGTGTTTTTGTTTGGAGGGAGTAATGTGTGCGCCTGTCCTAGAGCTATAGAGACGGCCCAGTAGAGGGC
TTCCCTGTTTCCTTGTGTGGTCCTAGATGTTTTTGCGGTGTTGGACAATGAAAACGTGTC
Sequence Type genomic DNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109119423..109119722 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es