Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P118F02
Clone ID P118F02
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP118F02
Sequence
AATTTCATTTACATTTCCAATGCTATCCCAAAAGTCCCTCACACGCTCCCCCACCCACCCACTCCCACTTCTTGGCCCTG
GCGTTCCCCTGTACTGAGGCATATAAAGTTTGCACGACTAATGGGCCTCTCTTTCCACTGATGGCCGACTAGGCCATTTT
CTGATTCATATGCAGCTAGAGACAGGAGCTCCAGGGGGGTACTGGTTAGTTCATATTGTTGTTCCACCTATAGGTTTGCA
GATCCCTTTAGCTCCTTGGGTACTTTCTCTAGCTCCTCCATTGGGGCACTGTGATCCATCCANATAGCTGACTGTGAG
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13182900..13183216 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]


SPLK-Sequence tag 3SP118F02
Sequence
CGGCAGTTTGTAATTTTCAAGCCTCCTCTGGGCATATGTATCTAACGGAGGGCTCCTCTTGGAAAGGTCCAGCCATTTAG
GATTATTGGTTGATAATAGAGGTGAATTTTTCTTATNNTGGCCTTTAGAAGCTTTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es