Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P118D05
Clone ID P118D05
Vector ROSAbetageo0
Project ggtc

Sequence tag P118D05
Sequence
GGGGGGGCNGNNTTAAAANNNCAAGGGGNNATGGGCCGGGCGTTTTTGGCGTCCGTGTGNNNGTGCGGGCGGAGCGAACA
AAGACCGGGCCAGAGGAGCCAGCAGCCCAGATCCCTCTCGCTGCGTTTCACCAAAATAGTTCTGGAATCATGCCTGAANN
TCCGGAGGCCATGGAACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP118D05
Sequence
GCAAACTTTTAATTTGGGGGAGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP118D05
Sequence
CTCCTGCCAACAATGCTTTGATGTTTTCACACAGCAATAGAAACCCAAA
Sequence Type genomic DNA
Unitrap ID UNI29519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40504966..40505015 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es