Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex331
Clone ID Ex331
Vector pGT0asgp
Project baygenomics

Sequence tag Ex331
Sequence
AATTCCCTGCCTCTGGCTTCCCTTCCTTCCGCGCGAGCTCTGGAGAAGCTGCAGCACTTAGGCGCCGCCGCTGCCTCCCG
GGGCCTG
Sequence Type mRNA
Unitrap ID UNI3664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87560791..87560876 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es