Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex381
Clone ID Ex381
Vector pGT0asgp
Project baygenomics

Sequence tag Ex381
Sequence
TGCTACCTGCGTGTTCGCCTTCAGTGGATCGTGTTCTCGTCTCCCGTGTGCATCGGCGGTTCCTTTCCAAACCCAGTGCG
CCGTGAGGGCTCGGAGCCGCCTCGAGGGCGTCGTAG
Sequence Type mRNA
Unitrap ID UNI10183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56815031..56815150 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028431 (Ikbkap) NM_026079 inhibitor of kappa light polypeptide enhancer in B-cells, kinase complex-associated protein Gene [Source:MGI (curated);Acc:Ikbkap-001]

 
Come back to gene ENSMUSG00000028431


For any suggestions or comments, please send an email to unitrap@crg.es