Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117F02
Clone ID P117F02
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP117F02
Sequence
TCTTTAGCCTGGTGCGTTTCAGCTCAGTTTTCCTAGTCAGCTCTCNCNNCTTCCCCCCTGCATTTTCAGGTTTAGTTACC
CAGGCATAGTCAGCTCTCCCACCTTCCCCCCTGCATTTTCAGGTTTAGTTACCCAGGCATGTCAACTGTCACCACTTAGG
ATTCGTGTTTTCTCTTTGGGTTGGTCTTGGAAGTCTTCCTGCAGTTTTTTGCTTTAACATAATCTCGTAGTTTACTACCA
CTAATACGCCTTTCTACTTTATTTCCAAGGTGCATAGTCTGCCTACTCTTTACTTTTCTCCAGCAATTGTGTACAGTAAC
AATTGGAGCTTTTAGGTGATTCTATGAGGTACCCAGAGATCATTTATTTGAAGAGCATGCCTTTTTTTGGGAGGGCG
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41221015..41221411 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]


SPLK-Sequence tag 3SP117F02
Sequence
CACCATGCACCTCTTGCTTCAGTCTTTCTATGCTGGGATTTCAGTTTGCATGGATTACAGTCAAACACTACTGTGCCTGG
TTACAATGATCTCTCTCTCTCTCTCTCTTTCAGTGAATAGTGTTTATATTTATATCTTCTATTGTAAAGTTTTTAAGC
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41220636..41220793 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]


Sequence tag P117F02
Sequence
TTTTTTCTTTCAATCCCAGGACTGGCGCGTCGAGTGGGGGGGTGGGGCACTNNTTCAGGTAACTANGCGGCGGCGGCGGC
GGGTCCCGAATCCAGCGAGAGCATCAGCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es