Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117E05
Clone ID P117E05
Vector ROSAbetageo0
Project ggtc

Sequence tag P117E05
Sequence
TTGTTGCGNNTTNNCTCTGCCTTTCTTGTGTGTGGTTTTNGCTTGCCTCGTGGCGCGTCTTGNNGCTTCTTTGNNTTCTC
TTCTGGCGTTCTGTTNCTTCGCGTGTTTTCGTTGTCTCTGCTTNNTCTTGCCTTTGNNTCCNNGTGCCGTTGCCGTTCTG
CTNNGTGCCTTCTCCTTCCTTGTTCCGTTCNNTGGTTGCNNGGTGGCTCTNNNNGTGTGGTCCTGGTCNNCGNNNNGTNN
NTGTGGGCCGTCTTGTGTGGTTGGGGCGGNNGCGGGCCCCNNTGGCTGGCCCGTCNNNNTCTCTCGTCNNCCCNNNCTTT
TCGGTTGTGCGTTNNGTTCNNTGGTGTGCGGCTTTTTNNTGCTGGCTTCNNCCTGGTTCGTCTTTTGCCTGCTTTTTTNN
TGTCGTCTCTGTCTCGNNTTGTGNNTGTCTGGCCTTNNNGTCTGNNTCCCCTCTTCGCTCTGGTGTTGCTGGTTCGTGNN
NNTGCTCTTNNCNNGTCCTNNTTGCTGGGGTCNNGGGGTGCGGGTTCGCTGTCCNCCGGTGCTCCTCTGGTGCTGCNNNC
CCGTGGGGTGGGTTCGCGGGTGCCTTCCGCCGCGGCGNNNCCGCCCCCTCCCTTGCGTCCCCCTTCTTGGCCCTCGCCGC
TNNNCGTGGCGGCCTGCTGGGTCCGCGTCCCGCCTCTACTCCCGGAGGGCATGCAGAAGAGAGAATGAGCCAGAGGGACA
CGCTGGTGCATCTGTTTGCCGGGGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP117E05
Sequence
AATTCAGCTCCTGCCCAGGAGCGTGGGTGAGTGGGTACATTCGTGGGTGCTGTGAAATTAGGGCTCAATACATGCTAGAC
AAATACTATCAGGAGCCTTATCCCAGCTGTATTCCCTTTAGAAAGTAAGATTTCTGTCACAAATACTGGCTGCTTCTGGA
AAGATTCTCGTTGGGTAT
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004646..97004823 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


SPLK-Sequence tag 3SP117E05
Sequence
CATAAACATATTAATGTTTTTGCATAGTGGAAATGCATTCAGCTCCAAATACTTCATATGTTGCTAATTTTCACATTTGG
CTTT
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004550..97004634 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es