Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117C12
Clone ID P117C12
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP117C12
Sequence
GCTTCCCTGCTTGCCCTTCCTCCAGCCATGTGGTGCCTCTGACCCAGAGACTCCTGTCACCCTTCATTATCACAACCCAA
GGCACCCGATTACAGTGGACATTTGGACAAGTAC
Sequence Type genomic DNA
Unitrap ID UNI14517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153477653..153477766 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]


SPLK-Sequence tag 3SP117C12
Sequence
GCATTCCTTTGTCCCAAACCAACTTCCATGTCGGCGCCACCTCTAGTTCTGGATACCATTTCCAAGATAGCGCTTGCTAA
ATCTGGTTTCCT
Sequence Type genomic DNA
Unitrap ID UNI14517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153477790..153477881 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]

 
Come back to gene ENSMUSG00000027478


For any suggestions or comments, please send an email to unitrap@crg.es