Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P116E02
Clone ID P116E02
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP116E02
Sequence
TCACATTTATCCTTTCACCAGCACAATAAATGTTTTTAAAGCAGTACTGCCTAAAGACAGAGTACACATATGAGAGGCCA
GAAGATAGGTTCTCCTGAAATCGAGGTTGTCCTTGAAGTTTTTTATTTATGTGTAAATATTTGAATGACTACCTGTGTGC
AGGTGCTCTAGGAGGCCGGAAGTACTGACCCTGGAGTTAGAAGGATGTAAACTGAGAAACCTAACTCAGGTCGTGTGAAA
GCATCATTAATTCTTCAGCCACATTGGCCACCTTGCCTAGCCAGTCTTAGAACTTAAAAGTTT
Sequence Type genomic DNA
Unitrap ID UNI15525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86240018..86240320 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es