Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P116C05
Clone ID P116C05
Vector ROSAbetageo0
Project ggtc

Sequence tag P116C05
Sequence
CGCATACGCGCGTCCCCAACATNNTCACAGGCTGGGACTGCGCATGAGCAGCTGTCTATGTAGAGCCCTAGATCCAAAGA
CGGAGAAGGCTGCCGGGGGAAATCGGCGACTGAANNGGCCTGGCCCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP116C05
Sequence
AAAACCACAAAATCCTAGGCTGATTTCCGTGTCACGTATTATTAATGCTCAGGATGCTTCCGGATATACACCCAAGGTTT
GAGTAAGGAGCCTACCGCCGTTTCTGGGTAGCCTCAGAAGTTGCGCTGACAGCTGTTGGCTATACGGTTGTCTCGTGCGC
CTTGCAGTCTCTTTCATAGCCTCCTCCTGCAGGCCGTCCCACGAGCTTCAGGAGGAGCTCTTCCTCCTGTTTGAGGATGG
AGACCCCCTAGGTGCATCCGGACGCTGCCTCCCTTTGCAGCCTTACTTTCTACGGACAGTTTCACTTTCAGTTCCCTTTT
GTTATTGTTGTTAACGTTCTTCTTTACACACGGTCTTTCCGAGGCGCATTATCCGCTAAAATAAGGTTTTTCTTTGATTA
GAAAGGTTTGGAAGATCTTGCGGGTAGAGTGTTTAAAAAAAATCTTGTCCTTTCTTGTTGAGATTATTTTATTGCTTTGT
CCTATGCAGCTGTTTCTTTCTGGTGGCATCTGTCTGTACAGTTCTTTGTTTTTTCCCGTTCTCTGGCTGGTTGTCAAAAG
TCCTAAGGCAGGAACATTGTAGATGGATTCCTCCCCCATTGTCTTTTCTCCTGCAGAACCCTGAGCCTGGAGGTTTTCTT
TCCCCCCCTCCTCCTGAGGCTTAGTTGATTTGGAGTTGTCATGGCAACATTTTTAGCAACTGTGTTGCTCTACAGGAAGC
CTTGCTGAATAAAATAAAGAAGCCTTGAACATGATGCAC
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173342133..173342897 716
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]


SPLK-Sequence tag 3SP116C05
Sequence
CTGGTGTTTGTACAGATGCTGTAAATCTGGACTCTCTCAAAACAAGAGCCCCGACAGCGGAGTAGTATCCAAGAGCCAAA
CCTGGGTTTTATGCTTAGTGATGGTTTCCCAATAGCAAAAAAGGTTTCAGTTTTCCTCTTCTTAGATTTGAGGACTGGAA
TTC
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173342905..173343067 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es