Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P116B06
Clone ID P116B06
Vector ROSAbetageo0
Project ggtc

Sequence tag P116B06
Sequence
GGCTTCCTTCTCCAACAGGCGTGGGTCACGGGCTCGCTCGTTCTCTTTCTGCCGCCATCTTGGTTCCGTGATCTCCGCAC
AAAATGCCCGGTGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCACAGCCTCAGGCTGAGACAGGATCGGG
AACAGAGTCTGACAGTGATGAGTCAGTACCAGAGCTCGAGGAACAAGACTCCACACAGACGGCCACGCAGCAAGCCCAGC
TGGCAGCCGCAGCAGAGATCGATGAAGAACCTGTTAGTAAAGCCAAGCAGAGTCGAAGTGAGAAGAAGGCAAGGAAG
Sequence Type mRNA
Unitrap ID UNI8492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472659..127483862 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


SPLK-Sequence tag 3SP116B06
Sequence
AAAGCTGCTCCTAAAGTTAGAAACTTAATGTTCATTTCTCTTCTTTAGGCTATGTCCAAACTGGGTCTTCGACAGGTTAC
AGGGGTTACGAGAGTCACTATCCGAAAATCTAAAAATATCCTCTTTGTCATCACAAAACCCGATGTCTACAAGAGCCCAG
CTTCAGACACCTACATAGTGTTTGGGGAAGCCAAGGTTAGTAA
Sequence Type genomic DNA
Unitrap ID UNI8492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127484666..127484868 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es