Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P115H09
Clone ID P115H09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P115H09
Sequence
CCGGNNNCGACCCGCTTCGGTTGGCCAGCACATTGAGGCAGCACATCCACATAAGTTGCCTTTTGACAGAGCTGTGNNCA
TGGCAGCATGGTAGGATCCGTGTCCCGGACCCTGAGCNCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP115H09
Sequence
TCTCTTCCCTTCCCAAGTGAACTCTGGGTTCTCTGACTTTCCCTAGGCTGGTGTCCTATAGTGTTTAGTAAGACCTGGCT
TCTGAGCGGTCCCTTTAAGAGGGCCTTGTCCCAGACTCAGCTGTGGAATGCCAGTAAGCTGTCCTCTTGTCTCTGTGAGG
GTTAACAACACTTCACTTCAGCTGTGTTGTCTGGAACCGGTTCAGACTGGTTCTCTGGAAAGTGCTTTGTCTCTCTGACT
GCATCCTGGGAAGGGTCATGTGGAGCCCAGTGATGTCATGGGATCAAAAACTGACTCAGCGTTTTTCTCCCTTTTCTTTG
AATCAAGATAAATGTGTGCCACATGTACAGGGCCATGGTGGTGGCACTTTGGGATGGACCAGTCCATACTGTGCTCAGAG
TGTATGTCTGCCAGCCAAAAAGCTTAGCATGACCCTCACTTCTGGCTCCCTGGGGGGCTCAGGCACACAGCACCTGAGGT
CACCTCTATCCAGGTCCTACACATACCATTACAAT
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72460246..72460761 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 3SP115H09
Sequence
AATACGGGTCCCAGCGCCCTGGACTGGTTTTCAGACCCATAATAGGCACCGTTCTTCCACAGAAGGGCCCTGTCCAGTAA
CAGCTGCCACTGCTTTTCTCCCACTTGGATTCCATGGCTTCTCAGAGCTGGCCACACCCAAGAGGCCTGTGGGACTCCTT
CCTGCCCAGCCATCCTAAGGGTGTGAGGGGCGTCTATGGCCCTGTCTTTGTTGTCCCTTCTCTAGTTAGCTGCCTCTAAG
GAAAACAAAACCGCACTTCAAACTAAACTTGTCAGAAGGGGTTCAAATGCTATATCCTCCTTTTCGCATACAGAATGAGT
GAAGAAGCATGCCGAACCCGCAGTCAGAAGCGCACCCTTGAACCTGACCTAACGGAGGATGATGTGGAGAACAAGAAAAT
GAAAATGGAGAAAGGGTCATCAGAGCTGACAGTGGACGGAGACAGCAGGGTGATGCCAGAGCCGAGTGCAGGCTCAGCCC
AGGGGTTGCTGAGGACAACAGAGGCCATGGGCACAGG
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72459732..72460248 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es