Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P115G06
Clone ID P115G06
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP115G06
Sequence
TCAAGTCTAAGAGCCCAGTGATGGCAGACACTGGGATGCATCTGCTGAGTGGTGAGGTCTTGCCTGAGGACTGAGGAGAT
GAAGGCTCAGCTTTGGTCTGGTTCTGGATGTAGGACTTGGTTAAAGAGGGAGTTGAAAGGCTTGGAGTGGGGGGAAAGGC
CACACACAGACAAGGGAAGGCAGAATAGTTGCTCTAAGGAGTTCCTAGTGAAGGACAGCA
Sequence Type genomic DNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6102637..6102857 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]


SPLK-Sequence tag 3SP115G06
Sequence
AGGGCNNCCTATGTAACATATTCTGGAATGGTAAGTAACCTTAATATTTGCCCTCAG
Sequence Type genomic DNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6102555..6102611 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]

 
Come back to gene ENSMUSG00000046792


For any suggestions or comments, please send an email to unitrap@crg.es