Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P115B02
Clone ID P115B02
Vector FlipROSAbetageo
Project ggtc

Sequence tag P115B02
Sequence
TTTTAAAAGCTCTGTGCGGGGAGGTGGGGGGCGCTTTTACGAGGTATCAGCACTTTTCTTTCATTGGGGGAAAGGCGTGA
GGGAAGTACCCAACAGCAGCAGACTTTGAAACTTTAAACAGACAGGTCTGAGAGCCCGAACTCTCCTTTTCCTTTGACTT
CAGCCTCCAAGGAGTTCCACCACTTTGGCGTGCCGGCTTCACTTTCATTAAGTGAAAGA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP115B02
Sequence
GATCTTATGTAGGCCGACTTTCAGGGTAGCCTCTGTCTCACAGCTCTAATCCTCCTCCCTCATGCTAGGAAAGTATGAGA
AC
Sequence Type genomic DNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56106564..56106645 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]


SPLK-Sequence tag 3SP115B02
Sequence
TCAGATGAACTTAATTCAGAATGTGCACAAATTACATGTTGGCTATGTCAAGGCGAAACCTTTCAGAGAAAAACTGAGCT
AGCCTAGCATCTTGGGAAGCCAGGCTGGTTGCTGAAGGGCCGTCACTCAATCCTTTCTTAGCTGCCTATACTTTATTTAA
TAATACATGTCAACGGTTTGCTTAGAGGCATACAGACCCTTGGACTCCCAAGAAAGAACTGGCCTTATTTATCAGACAAC
TAAAATAAGCAAAGGCACTTGGTAGGTAGAGCCTGTCAGGTCACATGGCAAGNNGGTGTCCAGAGCCTTAAGACTAAATA
CATCTTCGGCAAGGTGCGCTCGCTCTTCTCCCTGTATCTGGGTGCTATTACTTCCGNNCCAACTTCATCTTTGGGAAATG
CTGCCAGATTTGCCCTTGGATTCTGTTTTGGCTTGGAGNNAAACTGCCTTATTTTGACTGACCCCTGAAAAAAGAAACTA
TATATGTCAAACCATCAATTTACAGNCTAGCATCACTNNGGTGGTTTCGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es