Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P107F12
Clone ID P107F12
Vector ROSAbetageo0
Project ggtc

Sequence tag P107F12
Sequence
ACACACNNAACACCTNNCACCCANNCCANNACCACACACNNCATCCCCATACCCACAACACACACAAACGACCACACNNC
AAACTCATACCCCCCGCATTCCTTACACCAGGGNNCACACCCATTTCCNNANCTCTTACACNNNNCCCGGTTACTACCAT
AGCGGCTTTCCCGNNCCCCTGGAACCTCCACCCCNGAANCAAGCNNTATCGTCTACTTACCCAGTTCCCTGCGTNNCCGG
AGAGTATCCCTCTGAGCCCAGCCTCACCTCACCTTAACCGTCTCCTCCTCTCCCTTGGAGAACCCCGCCAAGCCCTCCCT
GCAGCCCCAGTGACAGGAGGAGACCATACTCCCCGACAGCGCCATGGCCCAGATTCTGCCCATTCGCTTTCAGGAGCATC
TCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP107F12
Sequence
AATGATATGAGACTAGGATGGAAATGACGAATCGGAGTGCAAAGGGCGGCGAGGCCAGGCCTTACGTCTGACGACCTCTT
ATTCTGCTTCCTGGATTGCAAGAACTGCGCATACCAGACCCCCCTTCCCATTTTACTCAGTTCATTCATTTGGGTAGGGG
CTAGGTGGGGGAGCTTCTCGCGCGTTTCTCCCAGAGCAAGATTTCTCGTTAACCCTGAGCGACGCGGGGCTGTCACCTTC
CCTTGGTCTATCCCCATTTCTACATCGAGTCTGCACCCAGGAATTGTGTGGCGGGTGGGTTGGGGAGGAGCTGCATCCTC
CCTCTGCAGCTCACCACTGAGAAAGGCACCTTGGGGTTAGGGTAGCAGTGGCTCGTGGCTTGCCTTCCCTGAATCTATAA
GGAACCGAAGGTCACACTCACTGAAGGAACAGAAAGAAGATAGAGGGGCGGCAAGGGGCGGTGTCAGTCTCGGTGCCTGG
GGTCAAGGTCCCAAGGGGAACGCGCATATTTTTCCTTTCTTNGTTTCTTCAGAGGGTTAGTGTAGCTCTTAGGCTCACTT
TGATTCTTGCAGGTAGGGAGAGTTATTTAGAGGTTATTTATGGCCTTTTGG
Sequence Type genomic DNA
Unitrap ID UNI29524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86569982..86570592 607
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es