Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DTM016
Clone ID DTM016
Vector pGT1&delta
Project baygenomics

Sequence tag DTM016
Sequence
TTTGTGAGCGAGTTCAGTACGTGCGTGAGCGAGTGATCGTAAAGGAGAGCGCGCGGACGACGCGCCCGGGACGCNCGGCT
GCACCGGNAAGCCCAGGCCAAGCGGTTTTGAGAGATTGCTACAATTTGGACTCACAAGCAAGATTTACTGCAAACTTTGA
GATGGAGTAG
Sequence Type mRNA
Unitrap ID UNI10187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83270448..83335515 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es