Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P107A03
Clone ID P107A03
Vector ROSAbetageo0
Project ggtc

Sequence tag P107A03
Sequence
AGCGCGAGAAGGAGACGNNNGTTGAGAGAACGAGGAGGAAGGCGAGAAAATGGCGTCCACGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP107A03
Sequence
AATTTAAGTTGAAAAGTGTGCTCTGCTATACCCACAGTCCTGGCCCTGCTGAGGGGGACTTTATTAAGGGCTTTCCTGAA
AAACTTAGTTTTAGAC
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4997457..4997551 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


SPLK-Sequence tag 3SP107A03
Sequence
CGGTTTTNNNNGGGGTCGATCTATACGGGTCGGGGCGATGCCCGGTGCTTGGGAGGCAGAGGTAGGTGGTCTCTGAGTTT
GAGGACAGCCAGGGCTACACAGAGAAATCCTGTCCTAGAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4997346..4997446 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es