Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DTM024
Clone ID DTM024
Vector pGT1&delta
Project baygenomics

Sequence tag DTM024
Sequence
CTCTGCCAACCTGGGCGGCGTGCCCAGCAAGAGATTAAAGATGCAGTACGCCACCGGGCCGCTGCTCAAGTTCCAGATTT
GTGTATCCTGAGGGTACCGGCGGGTGTTTGAGGAGTACATGCGGGTTATCAGCCAGCGGTATCCAGACATCCGCATTGAA
GGCGAGAATTATCTCCCTCAACCAATTTATAGACACATAGCATCTTTCCTGTCAGTCTTCAAACTAGTATTAATAGGCTT
AATAATTGTTGGCAAAGATCCTTTTGCTTTTTTCGGCATGCAAGCTCCTAGCATCTGGCAGTGGGGCCAAGAAAATAAG
Sequence Type mRNA
Unitrap ID UNI10189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58380715..58390000 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075700 (2810407C02Rik) NM_001040396 RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

 
Come back to gene ENSMUSG00000075700


For any suggestions or comments, please send an email to unitrap@crg.es