Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P106F09
Clone ID P106F09
Vector ROSAbetageo0
Project ggtc

Sequence tag P106F09
Sequence
TTCCTTCTGCAACAGGCATGGGTCACGGGCTCGCTCGTTCTCTTTCTGCCGCCATCTTGGTTCCGTGATCNNNGCACA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP106F09
Sequence
GAACAGCTGCTCGCCTGGTTACAGGAAGTAGAGGCCCGCGCGCCTGACCCGGAAAGCGCATGCTGGTTCCGCCCTCTCGG
CGCCCGCNNTCCTTCTTGCAACAGGCGTGGGGTCACGGGCTCGCTCGTTCTCTTTTCTGCCGCCATCTTGGTTCCGTGAT
CTCCGCACAGTAAGTGCCGCTGGCGTCTCTGCTTTCCATCCGTAGCCATCCTCGCCTGCTGCCAGCTTTGCGGCACCGGG
CATTTAAGTTTAACATCGCTGGCGGCTCTGTGGGGCTCAGCGTTCTTAGCTCGCCCCCGCGCCTGCGGGCAAAATGGGGT
CTGCGCTTTGGGTCCCAGCAACAGCAGGACAGGAGGGCCCCGGGTCCGGCTCCCGGTTTAAGGCGTGGGGACGCGGGAAC
CATTGCGGTGGAGCCGGAGAGGCTGGGCGCGTCTGCAGTTGGGAAGGGCGCCACGGGGATCTGGACGAGGAGGTTAAGGG
GGTCACAGCCTTAACTCGCAGCGTCGCTCGTCCTGGGGCACCCCGTGTTCTTCTTGCTCTGCGAAGTGGTCCTTAGCGAG
TCGGGGGGTCCCAG
Sequence Type genomic DNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472575..127473144 546
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


SPLK-Sequence tag 3SP106F09
Sequence
CCCAGAGTAGCGCCTGGACGCTCACGGTTAGGAGTCAGACCTTGGGATTGCTGCCCTTGTGGGATCGATCGGAAGAGTGA
CAACGAGGATCTGGCCAGGGCGAAGTCAGCTCTCTGCTAAGTGAAGCGGCTCCGCGAGGTCAGATCCTCTGAGCAGGCGT
CCCAGGGTCGTGGCGTAGTTTGACCCCGTTTCCAGTTGCTTTGGGGAGGTTGTCCGGATCCTCGGG
Sequence Type genomic DNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127473179..127473404 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es