Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P106D10
Clone ID P106D10
Vector ROSAbetageo0
Project ggtc

Sequence tag P106D10
Sequence
TCTTACGGCCGAAGCGGTTCGCGCTGTGAGTCGGTGGCNNNTGCAGGGCACTTAGGAACCGACAGCCTTGGCGCGGACTG
GTATCCGGTTGATTGCGGTTTGCAGGGTCCGCCATGGAGTCGGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAAAA
CCCTCACTCTGAGTACGGGCTCACAGACAGCGTTGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77602926..77603564 123
NO GENE  


SPLK-Sequence tag 5SP106D10
Sequence
TTATCATTGACTTTTCTATCTANNNTCCCCTGTATTTTGAGTCTCTGCGGCTCTGGATCATGTGTTAGCTCAGGAAGTAT
TCCCGAGCCGTCCAGGTAGTTTCCCCTGGTCTCTGGTAGCCGTGAGTATAGATCCAGTTTCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP106D10
Sequence
CCTTTTTGCCGTTTCTGTAGCACATTGTAGTCTTTCTGTTTTTATGTTTGGGATATGTCTGTATCATGTGTATATTTGGG
GTATGCTTGTATCCTATGCATGTTTGGGGCATGCCTGTATCATGTGCATTTAGGTTAATCCACAATACTGACTTCTAT
Sequence Type genomic DNA
Unitrap ID UNI14400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74709697..74709854 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es