Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DTM030
Clone ID DTM030
Vector pGT1&delta
Project baygenomics

Sequence tag DTM030
Sequence
GTTGGATGACATGAACTTTGAGATGGAGTTTGTCACCCGTGAGGGACTGGCTGCCTTTCCAAGGCTTGTGCTATCTGAAG
GGACCATCTGAAGGACGTGTTTGTGTGTGGAAAAGAGGGCACCAGCCTGACGTGCGTCCTCCACCATGTTCCTGTTGCTA
CCTTTTGATAGCTTGATTGTCAACCTCCTGGGTATCTCCCTGACCGTCCTCTTCACCCTGCTGCTTGTTTTCATCATCGT
CCCTGCCATCTTTGGAGTGTCCTTTGGTATCCGAAAGCTCTACATGAAAACACTGCTAAAGATCTTTGCG
Sequence Type mRNA
Unitrap ID UNI10190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24301188..24301497 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031545 (Agpat6) NM_018743 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) Gene [Source:MGI Symbol;Acc:MGI:2142716]

 
Come back to gene ENSMUSG00000031545


For any suggestions or comments, please send an email to unitrap@crg.es