Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P106C09
Clone ID P106C09
Vector ROSAbetageo0
Project ggtc

Sequence tag P106C09
Sequence
GCCGCTGCAGCCTAGTAGGGGCGCTTCGTCCAGCATGAGCTCGGACATGGCAGCCNNCGAGTCGGAGGCCCCAGTACTCT
CGGAGGACGAG
Sequence Type mRNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72510330..72510420 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 5SP106C09
Sequence
GGTCAAAGGTCATGTAGCAGTACGTCAGAGCACACATCTGTCATGGCAAGTGGAAACGGAGGGCCAGAGGCATGAGCGCC
TGACTAAGACCAACCAGAGCTGTGCTGTGAGCGCCTGTCTCCAAAAGAAGGAAATGGATTCAAACAAATCTGAAACAAGG
AGAAAGATGAATAGAAATGGCACAGAATGTAGAGAATTGTGGCT
Sequence Type genomic DNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72513567..72513770 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es