Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P106C06
Clone ID P106C06
Vector ROSAbetageo0
Project ggtc

Sequence tag P106C06
Sequence
GCGCGACGAGGCCGCCTCTATGGTCTTCCTCTCCTTCTGGAGTCGGGAAATGGCCGCTGTGTAGTTAGCACGGAGGTAAA
CCCCNGCACCACATCGTGCTTCGGCGTGTCAG
Sequence Type mRNA
Unitrap ID UNI374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20032299..20032410 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]


SPLK-Sequence tag 3SP106C06
Sequence
AAAAAACCNNNTAGTCACTTCAGACTCCCATCNTGTTGGTACAGCATATATATTTATTTTGTATTAAAAGGGAATCGTAG
AACAAAATGTCTTGTCCTCACTATGAGCTTGTATTCTAGATTAGCCCTAACTGGGATAGTTGGTACTGTTACGCAATAAA
GGACCTTTAAAGACTTACCAGTTTGCATTTTTTGTGTGATTCTAACCAA
Sequence Type genomic DNA
Unitrap ID UNI15623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20033792..20033997 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es