Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P106B06
Clone ID P106B06
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP106B06
Sequence
CCAACCCCTCCCCCTCAGCCGCCACTTCCTTTGTTGTTGCTTTTGTCTCACGCCGAGCACATGGTCCGGGATCCTCGGCT
CTTAAAGTCACAGTGCTCTAGCCCCAGCGCTGCTGCCTGCCTATTCCCCTCAGTGTTCCTCCGAGTGCGGCATTACGGAG
AAAGGGGAACAACGGAGGCCCCTCCTGAGACAGGTGTACGAGCTTCGGTCCCATCCCCAAGGAGGGGTAGCTTTGGAAAA
CTGCTGGAGCCCCACGGCCTGCTTTGGGGAGGAGCCTTATCCTCTGGGACTTTGTTTTCCTTCCCCATAATGTGAACACC
TAGTTTCTTGTCTGTGGCTTTTTTAGGGGCGCCCTGGGGAGATTTCAGTCTCTATTGTTAATAAGGCTTAGCCGAAACTA
AAGGGGTTCTTTAACCAAGGTCACCCAGGGAGTCTAAGCTGGCCAAGGTGTGGTGGTTCCGCCCTAAATCGCCTCCTCGG
CCTTTGTGGGAGTTGGGAAGCTCCTACTTAGAGGGAGGTACGGCGAGCATGTAGGGTAGGGGAACTTGTATTCCCACCTA
AGCCTGCTNNNCTGCTAGAGGGAGTGAATCTTTCTGCAAACCGACCCTATTCGACTCTACTCAAGGGTTAGAATGTGTGC
NNNGGACTCTGTACTTGGCTNNNCGGGGTGTGGACCCATGGGGACAAGAGATAGACTTAGGGGAGTTTACACAAACTTTA
TGGATAGAGAGCAGT
Sequence Type genomic DNA
Unitrap ID UNI22489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54787908..54788643 702
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

 
Come back to gene ENSMUSG00000034928


For any suggestions or comments, please send an email to unitrap@crg.es