Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105H11
Clone ID P105H11
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP105H11
Sequence
AATTTTTCTGGACATGAAGAGAGAATTAAACCTTTAGTTAGAATATTTCTAAAAATACTTTTGCAAAGAGTATTTATATT
TAAGACTTTCCTGATAGATACTCTTAGGGTCCCCAACATTATCTGTGTTTTTAGAAATGTTCACTGCTGTCATCAAAAGA
GCAGACATTTTCTAGAGTCAGTTACCTCTGCTGCTTACTAGTNNTATGCCCTTAAATAGGAAATTGTGTTTTTGCGACAT
CTCTCATATGAATGTCTGATATGGACTATAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP105H11
Sequence
CCCTTAACCATCCACCTACAAACTCAGAGGTGGGCCTTACCCAACTGTAAGCAAATCTTTTACAGGGACTAGAAAGGGCT
TGCTGAGCACTGCCGAGGACCACGTAGTTTTGGGTTGTAGTAGCTTTTCAGTTATTTCATTATTGGCACACTCAACTTCT
TGGCTCTCAGAGGAAGGTGAGTGTTTGTGTACGTCTAGGGCATCTAGGACTTAGGGCCTGTGGAGGACATGGGGAGAAGA
AAAATTAAGGCAAAGATGGGTTGAGGTGGCGTAGAGCAGAGCTTGTGTTGGTTAGGGAACGAAATCAGGGAGACAAGGGA
GGAAACACTCATGGCTAGAAACNNNCGTTGTGTGTGNNNTTGAGAGAGCATTACTGAGCGCTGCCTAGAAACCTCAGGTG
ATCTTG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857188..97857594 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es