Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105H08
Clone ID P105H08
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP105H08
Sequence
GAAAGAACAAGCGCCCTGATATTTGAACTTAGTCTGTTCTTGTTTGTAAAGTAAACCCCACAGTAGACTTACTGATTCCT
GGAAGGACTCCTTTGTTGTACTTTGGGATATCGCCACCACAGGCCGAATTGCCCTCCGGTGTGTGATTACGGTGTCATCA
GTACACACACTTGGGTGGAGCTTTGGAATTAGGAAGAACATGAAAGAAATATGGGAAGAAATGCTGCCTTTGTAGGTATG
GTTGA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30063695..30063939 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SP105H08
Sequence
CACATCTTTAGAATTGTAAAGAAGGCACTTTGTTATCCCTGTCCACTATTGGTGTGATAGCGTGTGCCTTTTACATTATT
TAATACTCAAGGATGTGCGTGTACTTTTAGACCTTGTCTGATGCCTTTCTAAAGAACAAGCAAATAGAACAGAATTGTCC
TTTCGACTTGGTTCTGCTTTGCNNGATTCTTAAAAACTGACACTTTGAAAATGATTGTATGTTAAGTCTTA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30064282..30064512 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


Sequence tag P105H08
Sequence
CACCACNNNGGGCAGTGTGCCACAAACGCGAGGAGGGGGGGCGCCTGACTTCCCTCCTNNCTGGCCGCCGTGTCCTCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es