Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105H01
Clone ID P105H01
Vector ROSAbetageo0
Project ggtc

Sequence tag P105H01
Sequence
GGCGANNNCGCGGCCTTGGCGGAGATTAAACCCGGATAGCGAGGCCTTAGCGTTGGTGAGGAGCTGCACAGTTTGTCGGT
GGCGGCTGCTCCGTCGGGGAGGCTTGAAG
Sequence Type mRNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80261442..80261550 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]


SPLK-Sequence tag 5SP105H01
Sequence
GGGTTTATTTTGGCTGATGGTATGAAGGTGCGGTCTGCCGTGGTGGTCGTGTTGCAGCAGTAGTCAGCAAGCAGATAAAT
GCCCTTCCCCGCGTTTTTAAAGA
Sequence Type genomic DNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80262225..80262327 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]


SPLK-Sequence tag 3SP105H01
Sequence
CCCAGNNCAGTTTTGTCCTAGTGTTTGTTTTCCCTCCAAAGCTCATGAACTAACTGCATTTTTGCAGTGTGTACCCATAC
ACATTCAACCTCAAACATGTACCCCTAGGGGACCTTATGCNNNATGGACNNGTGTTCCACCCTTGAGGTGCACCCTCACA
TCTGTGGCTGGATACCCAGGCTCCCTGCAGAGGCCAGGTATAGAGTCCTATGTTCTTGAAAGTTGTCTTTGCCAGCGGTT
GAAGTGGTTTTCCATCCTGCTGTTGCGGGTGCCCTCTTGCTCTGAGAAGCCCATGCTGCCACCCTTAGACTCTGCTCTTG
CATCTGGCCAACTTCATCT
Sequence Type genomic DNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80262837..80263175 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]

 
Come back to gene ENSMUSG00000020211


For any suggestions or comments, please send an email to unitrap@crg.es