Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105G06
Clone ID P105G06
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP105G06
Sequence
GTTAGTCACGCTCATTTTACTGCGGTCTCCCAGTTGGCTCCTGCCTGTCGAAGTGTGTGTTACAAAGTCTGGTTAGCGGT
GGAGCCCACTCTGTCTCTCCCGTCTGGTGTTCCCGTTTCTTATGTCATGAGTCTCTTTGTTAACTCTTCTTTCGGGAC
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379788..35379945 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]


SPLK-Sequence tag 3SP105G06
Sequence
TTAGGGAAAATAGGACGGGTGTAGGGATCGACGAGAAGTGACGAGTCCATTCGTGACTGATGAGTTTTTCCGGTTTTTTT
GTTGTCCCCTCTCCCAGCTCTTCTGTCGGAAACTGGTGTCTTTCCCCTTGCTGTTCTTCAACCCCTCTCTTTGGCCCTTG
CTTCCTCACCTGCTCTGGGACACCTAACTCAAGAGACCTCCCTTCTCCCCCTGCCGGGCCAATTATGGCAGAGAACGATG
TGGACAATGAGCTCTTGGACTACGAAGACGACGAGGTGGAGACAGCCGCTGGGGCAGATGGGACCGAGGCTCCCGCCAAG
AAAGACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCCGGCTTCCGAGATTTTCTACTCAAGCCAGAGCTGCTCCGGGC
CATNNNTGACTGTGGCTTTGAGCATCCATCAGAGGGTACATTTTATTGTTGGGTGTAGAGACCTTATTTAGCACCTCTGG
TGCAAGAAAAGGGAGGTTCAAGTCTAGGGTCATAGGATTTG
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379960..35380481 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es