Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105E10
Clone ID P105E10
Vector ROSAbetageo0
Project ggtc

Sequence tag P105E10
Sequence
CCAANNCAATCAACTCNNACCCAACCACNNNCATACNNAAACATACAGCGAAATGCACGAATCAGCAAACCAACGAACCT
ACCATCACAAAGGACAGCCCCACACAACACAAGACAACNNGCACAACACGCGACGAGCNNACCACACCTCCAAGCAAACC
ACAACACACACACNNACCCCGACCNNCCACACCCAAACCGACACACCNNCCAGCTNNTNCACCNNNAAACAACAACACCC
AAAGCNNCACACACAAATACATACCACACCCTAACACCATCAAAACCACCCTCAATCTCCAACACAGGGGGCAGGGGGGA
GGNNATTCAAGCACCCTGGAACCATGAGATGGTTCTGTCGCTAAGCCGGCTGTTCCTCCCCATGTTCCTGATGGCCACNN
ATCTCTCCGTCTACCCGTGGACGGTGNCGTCTCCTGACAAGCTGCCATGATGCTGCTCATGATATTATTGAGACTCANNG
GTGGGTCTGCGAGGAAATCCCAGATCTCAAGCTGGCCATGGAGAGCTATGTCCTGATCGACTACGACACCAAAAG
Sequence Type mRNA
Unitrap ID UNI4521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80218222..80228982 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061589 (Dot1l) NM_199322 DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dot1l-001]


SPLK-Sequence tag 5SP105E10
Sequence
GAGAGCGTCGTGCTGAGGCCAGCAACACCTCTGTGTTCCATTTCAGGTGGNNNTGCGAGGAAATCCCAGATCTCAAGCTG
GCCATGGAGAACTATGTCCTGATCGACTACGACNNNAAAAGGTGAGCAGGAAGGGATGGAGCAGGCTGTGGGCTGCACCT
ACCCCGCTGCCTACACCCTTGCTACGCTTCCTTCGGGAAGCTCTTTTGGTAGAAGAGTGTATCTGGCTGGAGGAGTGAGG
CAATCACTGGGAACTCCTACACTGTACACATTGAATTGATATGTGGGAAATTACCAGGGCTGGTGAGAGAGCTACTGGCC
GTTTTAACAGCAGGTCCTGCCAGCGCTATGTTGATGGGCCTCCACCTTGCCACCATAGGTGCTGGGTGAGGCCAATCCTT
GCCCCCACCTAGGTAGGCCTTCTGTGCAGAGTGGGCGGAGAAGCAAAGGCATCCCTGGAATGCTGCCTGGAGCCAGGTTT
GTTTTTCTTTGAGAAAGAATAGCCCAGGCTCTACCTCCTGCTCAGAGCCTGCCTAAAAAAGCTTTGCTTGACCTATGACC
TGATTATTAGAAAGGATTCCTGCCAGCCTTAGTGACACTGGGACAGGACAGTCCTACAGTC
Sequence Type genomic DNA
Unitrap ID UNI4521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80228862..80229482 609
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061589 (Dot1l) NM_199322 DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dot1l-001]


SPLK-Sequence tag 3SP105E10
Sequence
AGCAACGGGGTGTNNGTGGACTCCGAGCTTANNGCTGACCCAAGGCAGGAGCCTGTGTCCTTATAGANNTGGAATTAACT
ATCAGCCCTCTATCTCACTTTCTCTGTGAAGCTCCTGGACCCCAGGAAACGACTTTTTTCATGTGAGGAACCCACCCAGA
ACCCTGCAGTGGGACCCTCCACCCCTCTGGTCGTCGAGTAGGCTTTCTTACCTTACCTGGTGTGACCTCAAACTCCTGGG
GCTCGCATGACCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061589


For any suggestions or comments, please send an email to unitrap@crg.es