Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105A02
Clone ID P105A02
Vector ROSAbetageo0
Project ggtc

Sequence tag P105A02
Sequence
CGGCAGGGCTCTGCCTCTCCGGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGN
NATTCGCGTACTNNAGNNTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP105A02
Sequence
AATTCTTAAATGCCTTCGTGAGGGGACTGGGGGTGGGGCCCTTGTAGGCACGAATGCCTGGACTTTGGCTCCTGGTCCAT
TTTTAGGAAGAAATGGACGGGGCAAGGAGTAAAGGATAGTATGAGGGAGTGAGTCCCTGTAGGGCTGGCGCCCCTCCCCG
CTCTGCACACGCCCTGCCATAGGCGAGAGCTGCAGGGCTTTGAGGTTTTCCTGGCTCCTTCCCACCGGAATCCGGTGCTG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180437029..180437268 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SP105A02
Sequence
GCAGACACAGAGTTTAAGCTTTTGGAATGCTGGGCCGGGTGCTGTTCAAGGATAGCTGGAGGAACCTTTTAGTGGCATTG
GCTCCCAGCTTAGCCCCTTAGTTCGGGACGCGGGAATCTGTCAAGCGTGCCCGGCCAACCAGGCTGGCGCTCCGGGGAAC
CCGGGTGGCGCATGCGTGCAAGAAGGGCGGCACAGCCGATCGACCCTCGCCGTAGCTCGCTGGCCGATCGATTTCTTCCG
CTTGCCGCGCGGCCTACCACTCTAGGACGGTAGTCTCGCTGGTCTCTGCTCTATATCCGTGGTAGCTCTGGAAATGGCTG
CGGGATCCCGGCGGCCGGGGTAAGTG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180436659..180437004 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es