Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P104C11
Clone ID P104C11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P104C11
Sequence
TTATGGGNANNNCTCNNNGGCAGGGCTCTTGCTCTACGGGGNNGNGCAGAATCAAAAGGCTCGCCTCCTTTTGCGCAAGA
TGGGTGCTGCGGGTGCATTCGCGTACTGAATGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP104C11
Sequence
GGATCTGTCAGACACAATGACCACAGTGGCAGTCTCTTAACTCCATAGCTCTACCCGAAGCTATCCAGGTTGGTATCGAC
AAACTTTGTAGCACTTACTTTAACTCTGGGTAAAGTTGGATTATCAACTCAAACTTGTGCAAGGGAAGAGGCTGGTATCA
TGAGGAGAGAAGAGGGTTAACTCAGAATGTTAATGCCTCTGTGGATGGTGGATGAGCAATCTGCTAGTCCCCTAGTCTTT
TCTACAAACTAGCTCCTGTTGAGGGTTCTTCAGCTGCTTGACTTTGAGCTCATCTTTGCTGCTTGCATGACATTGTCACA
TATGTCCTCCCAGTACTATTTCTCCTACACCCTGACCTTCATTTCATGTAAGGCATTTTTTTGCCAGTTGATTGCACCCG
GACTCCTGTTGTTCTCTTTGGGCTGTGAAATGCTCCCCTCCACTGCTTGGGCTCCCTGGAAAGTTCCA
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443295..180443762 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SP104C11
Sequence
CCAGATAATGTTTCTCTGTGTAGGTAGCTTGGATGTTAGTAGTGTGCCTCATAGGCTGCTCATGGTGGCATACCTAGAGG
CAAGTGG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443144..180443230 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es