Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DTM060
Clone ID DTM060
Vector pGT1&delta
Project baygenomics

Sequence tag DTM060
Sequence
TGAGAGGTGNCTCCGCATGCGCNCTGGGTTGGGCNAAGCGCACGCTGAGGAGCTTCGGCGTCCGGGGTTGGTGTTCCGAG
TCTCCTCGTTGCCACTAAGCAGCACGGCGTGGGACCCTACTTCGGGATTCACACATCCACTTCAG
Sequence Type mRNA
Unitrap ID UNI10195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79963023..79963167 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021116 (Eif2s1) NM_026114 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2s1-001]

 
Come back to gene ENSMUSG00000021116


For any suggestions or comments, please send an email to unitrap@crg.es