Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P103H08
Clone ID P103H08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P103H08
Sequence
AAGAACGAAGCAGACCAAACGCNNCCAACACAAACAGCTANNAACAAAAAGNNCACGCACGACAGAACAGACCAANNAGA
AAAGAGAATCACCAACAAACAAAAAGCAAAGAAAANNCAAACACAAACNNAACNNAGCNNNNCCNNACAGAAAGATCAAA
AAACAAGATAAGCAACATAAGACACACAAGCNAAACCAACCCCAANNAAGAACATCANNAGGTCCAAAAAAACAACAGAA
CTANNAGCCAACAAACAAAAAACTCGAGGACGAAAGAGAACGTGGAAAACAACTATNNCGCAGAGCTCGANGAACTCAGC
GCACGCGAACAGGGGAAGGTAGAGTAGGGCAGGGCCAAGGTAGGAAAATCTANNAGGAGATCCAAGACTAGGATCTCTTC
ATGGAGCAAANNAAGCAAGTNNGTCAGGGCAGAGCTCAGAAAGCACAAGGGGGTTAGGGCGAAAGATGCTTATCTCCACC
TCGTGCAGAGCTCAAACGATCAGGCAGAGACAGTGGCACCCTTTTCTTTTACATCCCAAGAACCCTGCCCTCCCGACAGC
AGAGCCGGTGAGGGAGCAACAACAGCGGCGGCGGCTCTAGCGGCGGAGGCTTCGGCGTCGGCGACAGCGACAGCGACGGG
CTCTGGTGACGACTTCTCTGAGGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP103H08
Sequence
TGAACTTGAAAAATTTAACAACCTTCAATTATGTACATA
Sequence Type genomic DNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155982774..155982812 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]


SPLK-Sequence tag 3SP103H08
Sequence
AAACGTCTTTCCTTGTTGTCAGTTATGCTTATTTAATTGTATAGGAAATTAATCATTTCAGTAATCTTTGTCAGCTGTTA
TATCCCTTTGCAAAACCCTGGTCTCTGAACTTAACCCTGGAACTTTATTCCATCAATTAGGGGTTTCCTTGCAGTACACT
TTGAAGCTCTTGGGAAGAAAATTTAACCCGACCCATATTTCTTTCTGTCCATTTCTGTCAAAAAGTATAGTGTACTTTAA
TGTATGGCCAAAGTGAACATTTCGAGCAGCTCACTTGATGCTGCGCTTCAGGACTTTTTCTCATAAAAGCAAGAAGCCAG
CCAAGTCTTCTTACCATCGAGTCGGCCGAGCTCAGACCGAACGACTCTGAACTAGAGTTAACTCTCTAGAAAGCGTTTTC
TAACCTAACTTGGACCTTTGTGATATTCTGAAGCTTTCTTGGTTTTGT
Sequence Type genomic DNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155982841..155983288 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es