Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DTM063
Clone ID DTM063
Vector pGT1&delta
Project baygenomics

Sequence tag DTM063
Sequence
GCTCAGGAGAGGCCCCGGCTCCGCNCCGGGCNTGCCCAGGGGGAGAGCGGANCGGTCANCAGCCGGGTCGGGTCGGGGCC
CCTCCCGAGAGGAGAGTGGAGCGGCAGCGGCGGCAG
Sequence Type mRNA
Unitrap ID UNI10197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105043250..105043365 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 145364504..145364619 108
NO GENE  

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es