Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P103G05
Clone ID P103G05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP103G05
Sequence
TGTACAGACCGCTCTAGGAGTTCCCTGTCCTGCCCTGGCAGTCACCACTCCTGCAAACTCCAGTTTCCTGTTCTGTGGTT
CCTCCAGGCACTCTCACAGTCAGCGGTAGAACTCGGCTCCCGTCGCTTAGAGAATGCATCTAAGATCAGCCTCTTAGGAG
CCGCTCAAGCTCCTTGCCGCTAATAATGTGCTCTTTGCACACTGAAGGGGATCGTGGTCGCTAGTTACTAAATATAGTAA
AAGCCTATTAAATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP103G05
Sequence
AACCCCGTGTCTTTCAAATAGTTAGCTACCCATGTTAATAATAAAATTCACAGTGAAGCCATCAGGACTGAGTTATGTGT
GGGAACCTAATTAGTCTTGTTTCTCCGTGCAAGAATGTCCGCCACTGTCCTGACCTGAACTTCTGTTGCTTTCATGAATA
ATATTGTATGCTCTTTGTCTTCGTTGAACATCGAAATAACTTTTTCATGGGTTGTCGCCATTTGTAGTGTCTTGGGGAGG
GACGCATGTCTTGTGAGCTTCCTCAGGCTGTTGTACCAGAAGCCCGAGTGCTCCTTAGTGTTGACCCACCCGACCTTGCT
CACAAACACAGCATCTCAAAAACATCACAGAAACAAAATGCGCAGACTAGTTGTACAGTTTTCTCCTTTTTTAGGCAAAT
TTTTCTCAAAATAACTTCTTTTATTCCCTCCTCCTCTCATACTGACACCAAAAATAAGAAATTTCTGTTGTCACTAACAT
TTGCTGTGTTACTAATTCCAGACCTCTCTCCCTTCATCTGGCTTCAGATGTCAGCAGTGTGNNATCCTCGTGAAGTGTTT
TTACAAGCCGTCTCCCC
Sequence Type genomic DNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51042943..51043522 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]

 
Come back to gene ENSMUSG00000023087


For any suggestions or comments, please send an email to unitrap@crg.es