Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0045
Clone ID CC0045
Vector pGT0lxfT2
Project sanger

Sequence tag CC0045
Sequence
CTTCTTCCATCTGATCATCATCCACCTGTATCCTCCTATCCTCCATCCTCACCGCGCCGTCCTTATCTTTGGCTCCTCGA
TATCTCGTATCATACCGATTACCCTTATTTTATATTCCTGTTAAGATGTCTGTGGACATGAACAGCCAAGGGTCAGATAG
CAATGAAGAGGACTATGACCCAAACTGTGAGGAAGAGGAAGAAGAGGAAGAGGACCCTGGGGACATAGAGGACTACTATG
TGGGAGTAGCCAGTGATGTGGAGCAGCAGGGGGCTGATGCTTTTGATCCTGAAGAGTATCAGTTCACTTGCTTGACCTAT
AAGGAGTCTGAGGGCGCCCTCCATGAACATATGACCAGCTTAGCCTCTGTCTTAAAG
Sequence Type mRNA
Unitrap ID UNI1144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108546357..108546615 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es