Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P103B07
Clone ID P103B07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P103B07
Sequence
GCTTCCTGGAACAGAGACGCCTTCGTCGGCTCCCTGCGGGTGACCGAGGCAAGAACCACAGCTGGTTGTGTGCAGAGGCC
AGCCGCCACTACT
Sequence Type mRNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011391..98011484 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]


SPLK-Sequence tag 5SP103B07
Sequence
GATCCGGAGACCGAGGTCATCTGCCTGCCGAANNNAGCCCCGGAGCCACTATCCCCGGAGCTATCGCCTCCCTTCCCAGC
GCTCCTTTCTCCCCGGCGATCGCCANNNCTTCCTGGAACAGAGACGCCCTTCGTCGCNNNNNTGCGGGTGACCGAGGCAA
GAACCACAGCTGGTTGTGTGCAGAGGCCAGCCGCCACTACTGTAAGTTTGCCCTGCAACCCCAAACCTGTTGCGGGCGCC
CGGGTTTCGGGCGGTGGGAGTCGGCCGCGGGGTGTGCTTGGGAGCATCGAGNNGGCGCCGGCCACCCTGGCTGAGGCTTA
AGCCCAGGAGGTGCTCTCGAGGCAGAACAGTCGCTGGAGTGGGAACGGCACTGGGAGAGCAACTTGCCTCCCCTCTGCGG
TGTAACGCCCGGGCAAGTATCGGTGGGTGCGAGGAACCAGGTTGGGGATAATATCCCGGCTCCTAGCAGTCTCCAGGAAG
CCCAGCGCGTGGGATCGGTTCCCCAGGGNNTCTCGTAACCGGCTTTGGGGCGCGGCTAAGGGCATGCGCAGACCTCCCTC
TGCGGCCACTTGACTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP103B07
Sequence
AAACTGGTTCCTGAAAAACGAGTTTCTTCTCCTGCAAGCTTTTGCCTTTTAGAATGACATTATTAATTTCAAAGGCTAGG
TAGGAATTGGTGGGCGGGGTGGAGATGAAACAGTGGACTTGGACTTGTAATTTGGTGTCGTCCTCACTGGCATGTCCAGC
GTGTTGAGAGTAGCCGTTGCAAGTGTTGGAGGGGACGGCGTGGCCAAGAGCTATTTTGGTAAACATCTTTATAGTGTGGC
TCCGTTGTTGTCAGTAATGTGAGTGCTTGGGAACGTCTGCCTGGCTTCTTTGCTCGTGGGATCGAGATCAGGCTTAACCA
GGAGAGAGATGGAGGTGCTCCCAGTGTTGGAGGCAGACGTCCTGCCTGGAAGCAGCAGGAAGTGAACTGAAGTCACTGAA
CTAGGTGCCCTTTTGATGTTCACAGTAATAGCAGTCTTTTTCTCTGCCTTCTTTGTAGACGCAAGTTAAGTATATGTGTG
CATTTTGGGGGTCATTTCCTTAGCATGCAGATTTATGTCTCTGGGGGCTTTAAAAAATGTTGGAAAGGATGATTCATTTT
ATGTGGGAAGGTGTTTTTTAGTAACCGTATGTATAAAATATGTCTGGATATTTTGATGTTTGCATGATTCTAAACCAGAG
AGCACGTTGTCTCCCTAGGGTCTTCAGGAGCACCTTTTGTTTTAATCATACAGGGNNTGCAAGATGAGAGATTGTGACAG
TGACATTCTCTCCCAGGGGGATGG
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011875..98012618 717
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es