Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P102H09
Clone ID P102H09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP102H09
Sequence
AATTAAAGGAATTTCTTTGCAGATTGAGAGGAGCATGCTTG
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165704994..165705034 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


SPLK-Sequence tag 3SP102H09
Sequence
ATGGGAGGAGGAGCTGTGGCTTGGGTATCAACTATTTCTTACAGTCTGGACCCTTTTGGTCTTTTTGAATGAACGTAAAA
CCTAGGGGAAGCGCTTGGGACTGGTTGCATGATTTCCTGAATTGCTGTGTGATATTCTTCTGACTAGGGCAGCGAGGTCT
TGTGCATGCTGGTTCTGTGTTCTTGCTGCCTTACAGATTGTTATAAAGTCAAGCCGTAAGGACACTTGGGAGAAGCAGG
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165704692..165704931 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es