Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P102B04
Clone ID P102B04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P102B04
Sequence
ACAAACACCCCAACCCCACGACCANNCTCCCTAAACAACCCAAACCCCCACCCCAACCTCCACCCACCACCCCCAAAAAA
CGCAAACCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGCCAAACCAGACACAGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNCTAACCNNCNACCCTCCTAAACANNNNNNNNNNNNNNNNNAATCTGC
CATTTTCTCTACCTGAGTGAGTCTCTGCTGTCCGGAATTCTCTGGTTTTCTTCGCAGGCAGTGTTCTGCCCACTGGCCCA
CCACCTCAGGGGAACGATGNNNACAGAGTCTACAGCNNCTCCNNNCATNNNCNNNGANNNGGTNNNNNCTGAC
Sequence Type mRNA
Unitrap ID UNI1110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116299976..116300098 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 5SP102B04
Sequence
TTTTCTGATAGAGAAACTAAAGCAACAGTAGCTCCGAGATGCTCTCTGGCATATTACAACTGTTGATTATATCACGACCC
TCCACCCGTCCACCCGGAAACAGTTAACTATTGATTGGCCTCTGCTCCTTAGCCCAGCATAGACTGTAGAGTGGTGCACA
CCGGTCCTGGTCCTTTTAAAACTCAAAGTCTAGTGCCGCGTACATAGTT
Sequence Type genomic DNA
Unitrap ID UNI12218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4538275..4538484 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]


SPLK-Sequence tag 3SP102B04
Sequence
AATGAACGCGAGGAAAGAGTGGTGTGTGGTGTTGCATATAGGAGTGTATACCCGCACTCAGGACACTGAGCGAGGAGATT
GCTACAGATAAGAGCCAGTTTATATGGAAAGACCTTGTTTCATAGTATTTGAGAACAAGAGTATGTTAATGCCAAGAAAA
GGACTTAGAAGAGCACTCAGTATCAAACAAACAAGCTGCTCGAGTCATATCAATATGGCTTATATTGCGAGGACTGGGCC
AGAGATACTGACTCGTCAATGTGTTTTATATCACCTGAGAAGAAATAGCTGAACATATCCTCAGCTTGTCTGTGAGAAGA
GAGAGACTTCCTCCTCCTAGGCTTGAAGAATACATGTGGGTAATATGCTCTTTTGCTGGCATGNNCTTAGANNNGGGTCG
TTGNACTGCTTTGCGATGGGAGGAACNATACANNTGTCCTTCCTGTAGATAGGGACGAGTTGTTATTTTAAAAAAAGAGA
ACACTGGGGGGGNNNCCGNNGGAGCTGCTCTGCTCANNTGGTTTTGTATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020412


For any suggestions or comments, please send an email to unitrap@crg.es