Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P101D02
Clone ID P101D02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP101D02
Sequence
CATTAAAATTGACAAGAATCATCTCTGAAGTGAATTGATAGTAGTGAACAAATTCAACGAGCTACTAAAAGTCCCAGCCA
TTTCTTCAGTATTTTGGGTCAAACGGATTATATAAGTGGTTAAAGCATTTCATCTGGTGTTATTTTTGTCTCTTTCCCCT
CTCCTGTTTG
Sequence Type genomic DNA
Unitrap ID UNI23500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112278286..112278455 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]


SPLK-Sequence tag 3SP101D02
Sequence
ATGTTTGATTTGTGTCCAAGTAGTTTCAGCAGTTTCAAATTACTGTTTAAATATTGCTGAAGTTTTGTGGCAGTTCTTTT
TACCTTTATTAAAAGTTTTAGTAATTTTTGACTTCAGCTTTTTTCATATTACAATGGGACAGCTTTTCTAAATGAAGACA
TTGAAAGAATACAGCGTTTTTTTCTTTTTATCTTTTATTTACTTGGGAATGTAAGATGTTCCATTTTCACACCAGCATGG
TAGTATTGAGATAGCTATTTGTCTATACACGCTGATGTTTAGAAGTAATCTTCAGATGTGAAATTTTTCTTTTTGTTTCT
GCTTTTTGGCACATAAATTGGCTATTTCTTCTGGAGTGGATAAGTACAACAGTGACAAATACATGGAACAGTAAAGAAGA
CCTTGCTCTTAAATCCAAGGAACCTGGCTAACTCTGG
Sequence Type genomic DNA
Unitrap ID UNI23500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112277823..112278260 434
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es