Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P101C12
Clone ID P101C12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP101C12
Sequence
CAGTTTAAAACATTTCCAGGCTAGCTAGTATCTCAGCTGTACCAAGTATTCTGTGTCCTTAATAGTCAACAATCTGTGAC
TCTTCTTCCTGGTGGTCCTCCCTCCCTCAGCCCCAGACCTTCNNNNACCTAAAGGGTTCATGTCTCACCTTTAGTGATGA
TTGGTGGCCATTCCAATTGATCGTTAGNATAACCTGGGACGTCCTCTCTCCCTCCTTCACTGACTAAGAACCACAAGACA
GTCTGTTGCCCAGATAACTGGATTCAAGGCCTCCGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP101C12
Sequence
CTGCAGAGTTGANNCTCTGTACACAGTCAAGACAGGACAGAGGCCATCTTTGCCCCACCCCAGCACTGAGCACGCAGNTG
TCTTAGAATGGGGACAAGTGTTACGTAAAAATTTATTGAGTCACCGNNNGCCTTTCTTTTCTCCCTGTCCAGCACCCCTC
TCTACCTGCCAACATCCTGTATTAGAGGAGCTTGTGGCTGGAGGTGTGACCGCGGGAGAGCTGGCCGGGGANGGGACCCT
GCTCAGTCGCTGCTCTGCTCCTGTCTCTTGTCCCCTCCCCCCGCCATGACAGAGACCCGTGAACCCACTGAGACTGGAGG
CTACGCCAGCTTGGAGGAAGATGATGAAGACCTTTCCCCAGGTGAGGTGGCCTTAGAAGTAGCAGTCTTGGAAAAGCTGT
CATCCTGGGGTTGGACCTCCTTGGGAAGCTGTGTTGAGGAGTGGCCGCCTGCCTTGCTACCAGTTCTCTTCTGACTAGAA
GTCTTCGTCCTGGTGGGAGATGGCTTCCCATGGAGGCTCTTAGGGGTTGCATCTTGGGTGGGCTCTCTGTCCTTGCTGGA
AGTTCTAGATTGGCTGAGGGCTCTACCCCTACTGTGGGTTCTAGNNNGGCCACGCTGGTTCTCCTTGCTGGAGATTCG
Sequence Type genomic DNA
Unitrap ID UNI19205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25295413..25296049 614
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064264 (Zfp428) NM_146183 zinc finger protein 428 Gene [Source:MGI Symbol;Acc:MGI:1916463]

 
Come back to gene ENSMUSG00000064264


For any suggestions or comments, please send an email to unitrap@crg.es