Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P100H08
Clone ID P100H08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P100H08
Sequence
GANNNTGGAGNNNTAGCGAGGAGTAGTTGAGAGAACGGAGCCGGCNNNATGGCGGCCGACATCGAGCAGGTTTTCAGGTC
TTTCGTGGTCAGTAAATTCCGGGAAATACAACAGGAGCTTTCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP100H08
Sequence
ATAGGAGGGGGCTTTGGAACTGCTGGATGCGTAATTTGATTGAGTAGAANNAGGGGGATGTGTTATTTTTGTTATTTTTC
CTTGCTACCCCGACTTAACGGACGGATTTTTGTCACTGCCAGTAGACTTCAGAGGTTAGCCTTGGTTCTCAGAATTTAAT
GTTGAAGAG
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648842..91649010 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es