Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P099G11
Clone ID P099G11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP099G11
Sequence
TGCANNNACCAACTGCATTGCCTTTCTAGTGCTTATGTCGTAGTGTCAAAACAAAGGAACATTTGATCTTTAGAAGTCCA
AGTCATAGATCAGTTTGATACAAGTGTATAGGCGAAAGTCTGGAAGAAGTAGCCAAAGTT
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32416776..32416915 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es