Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P099F10
Clone ID P099F10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP099F10
Sequence
CGGAGGGGTTTGAGCCTTGTTTCGCCTCTTGACCGGCTCCTTTATGCACTTTTGGGTGGATTAGAAAGGCCATTCTGAAT
TGGAGAATCTTTAACCTGCCCATGGAATAANNNGTTCCCGGNNTCTGAG
Sequence Type genomic DNA
Unitrap ID UNI10213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59040806..59040934 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048076 (Arf1) NM_007476 ADP-ribosylation factor 1 Gene [Source:MGI (curated);Acc:Arf1-001]


SPLK-Sequence tag 3SP099F10
Sequence
AGACCAGGTCAGTACACAATTCTGGCTGTCCATTTAGGGTGGTCGTGCCATGTCAGTTTGTAGTGTAGGTAGCTACATAT
GTTGTATGGTCTAGCTACATAGAACAAATGCAAAATGCTAGGGATTCTGTTCACATCAAGAAGGAATTCTCCCATTCAAA
CAGCAACTGGCTGCTTTGTCAGGAAAGGAAGGGTCAGCTGCTCTTGGTCCCAGAAGTCATTGGAGAGCCCAGTAGTTGAT
GCCACAACCCATGTTGGAGTCTTCTGTTGTAGTTCTTGTTTCACAACTAGTGGTCAGCAGTTTTTCCTGCAGGCTGATTC
TGGTGGTTTCTGCCGTGTCTGTCAGAAGACTAGTGAGGTGCCATGGTGCTTTGTGTGCTGGCCTCGTGTCTCTCCTCTGT
CTTAGCCAGTATCCACAGTGCCTGACATAGGTGACTATAGTGTCCTCACTTTTGAACTTTTAGCAGCACTAGCAGAAATA
GCCTAAACTATGAGATTTGATGCACTGTGTTACTACCTGGGTTCTCTGTT
Sequence Type genomic DNA
Unitrap ID UNI10213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59040259..59040789 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048076 (Arf1) NM_007476 ADP-ribosylation factor 1 Gene [Source:MGI (curated);Acc:Arf1-001]

 
Come back to gene ENSMUSG00000048076


For any suggestions or comments, please send an email to unitrap@crg.es