Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P099D03
Clone ID P099D03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP099D03
Sequence
GATCTTCTTACTCCTAGGATTAATGGCATACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP099D03
Sequence
GATGGAGANTTTGAATAAAATTTACCCCAAAGTTCAGTGAGGCCTAGCAATAACATTTTATATGCCATCTTGGAC
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95168122..95168196 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


Sequence tag P099D03
Sequence
ACAACAAAAAAAGGGGGCGGGGCCCGCAAGAAGCTCTAGCCCTGAGAGTAAGAGGCACTTGGGTTCGTCNNNNGNTTTTG
GCCAGCTACAGAGGCCCCCACGGAGCCCGCNNAGNCCCCCGTTCCTACTGCGCTGTCGCCGCCCGAATCGGAACCGTCGG
GCTGNNACCCCCCGCAATNNCGCGAAGGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es